Journal: Carcinogenesis

Article Title: Fisetin induces autophagic cell death through suppression of mTOR signaling pathway in prostate cancer cells

doi: 10.1093/carcin/bgq115

Figure Lengend Snippet: Effect of fisetin on mTOR target proteins. (A) Fisetin-mediated changes in mTOR target protein S6K70 and its substrates rpS6 and (B) eIF4B. (C) Western blot results of 4EBP1 and eIF4E are shown. Three different forms of 4EBP1 can be resolved by electrophoresis, the hyperphosphorylated γ form, the intermediately phosphorylated β form and the most mobile and non-phosphorylated α form. In western blots, anti-β-actin antibody was used to verify equal loading. Effect of fisetin on the formation of translation initiation complex by 7-methyl-GTP-Sepharose chromatography. (D) Cells were treated with 40, 80 and 120 μM of fisetin followed by affinity precipitation (AP) of the lysate with 7-methyl-GTP-Sepharose. The resulting affinity complex was washed and subjected to western blot using antibodies against 4EBP1, eIF4G and eIF4E. Effect of fisetin on Cap-dependent protein translation. (E) The structure of the bicistronic luciferase reporter construct is presented. The cassette is transcriptionally regulated by cytomegalovirus (CMV) promoter. The expression of Renilla luciferase (RLuc) is directed by Cap-dependent translation, whereas the firefly luciferase (FLuc) expression is driven by hepatitis C virus (HCV) internal ribosomal entry site (IRES)-dependent translation, i.e. Cap-independent translation. A stem-loop structure is inserted into the bicistronic structure to prevent the leaky scanning of the ribosome. (F) Cells grown in six-well plates were transfected with 1 μg of bicistronic plasmid per well and treated with fisetin 24 h after transfection. After 24 h of treatment, the luciferase activities of Renilla and firefly were determined using Dual Luciferase Reporter Assay System. The result is presented as relative Cap-dependent translation (%) compared with control that is calculated by (Renilla luciferase activity/Firefly luciferase activity) × 100. The data shown are representative results of three independent experiments and are presented as mean ± SEM; *P < 0.05 versus control.

Article Snippet: Total of 700 μg of cellular proteins in lysis buffer [20 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1 mM ethyleneglycol-bis(aminoethylether)-tetraacetic acid, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na 3 VO 4 and 1 μg/ml leupeptin] was mixed with 50 μl of 7-methyl-GTP-Sepharose-4B bead suspension (GE Healthcare) and incubated overnight.

Techniques: Western Blot, Electrophoresis, Chromatography, Affinity Precipitation, Luciferase, Construct, Expressing, Transfection, Plasmid Preparation, Reporter Assay, Activity Assay

Journal: Insects

Article Title: Green, Yellow, and Red Fluorescent Proteins as Markers for Bacterial Isolates from Mosquito Midguts

doi: 10.3390/insects10020049

Figure Lengend Snippet: Growth curves for green fluorescent proteins- (GFP-), YPF-, and RFP-labeled bacteria in the presence or absence of antibiotic kanamycin.

Article Snippet: Fifty μL aliquot of bacteria suspension was mixed with 2 ng plasmid encoding GFP (Altogen Biosystems, Las Vegas, NV, USA), YFP or RFP (Addgene, Cambridge, MA, USA).

Techniques: Labeling, Bacteria

Journal: Insects

Article Title: Green, Yellow, and Red Fluorescent Proteins as Markers for Bacterial Isolates from Mosquito Midguts

doi: 10.3390/insects10020049

Figure Lengend Snippet: Colony growth characteristics of four GFP-, YFP-, and RFP-labeled bacterial species across 14 passages. a: Escherichia coli , b: Enterobacter cloacae , c: Aeromonas hydrophila , and d: Aerococcus viridans .

Article Snippet: Fifty μL aliquot of bacteria suspension was mixed with 2 ng plasmid encoding GFP (Altogen Biosystems, Las Vegas, NV, USA), YFP or RFP (Addgene, Cambridge, MA, USA).

Techniques: Labeling

Journal: Insects

Article Title: Green, Yellow, and Red Fluorescent Proteins as Markers for Bacterial Isolates from Mosquito Midguts

doi: 10.3390/insects10020049

Figure Lengend Snippet: PCR-based detection of GFP-, YFP-, and RFP-labeled bacterial species across 14 passages. MW, molecular weight marker, positive control consisted of GFP, YFP, or RFP.

Article Snippet: Fifty μL aliquot of bacteria suspension was mixed with 2 ng plasmid encoding GFP (Altogen Biosystems, Las Vegas, NV, USA), YFP or RFP (Addgene, Cambridge, MA, USA).

Techniques: Labeling, Molecular Weight, Marker, Positive Control

Journal: Cell reports

Article Title: SUMO orchestrates multiple alternative DNA-protein crosslink repair pathways

doi: 10.1016/j.celrep.2021.110034

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Plasmid DNA was constructed either by standard digestion-based cloning or using NEB Builder HiFi DNA Assembly Master Mix.

Techniques: Virus, Recombinant, Protease Inhibitor, Immunoprecipitation, Clone Assay, Purification, Sequencing, Mass Spectrometry, Imaging, Western Blot, Software, Flow Cytometry

Journal: Cell Reports

Article Title: TSPAN5 Enriched Microdomains Provide a Platform for Dendritic Spine Maturation through Neuroligin-1 Clustering

doi: 10.1016/j.celrep.2019.09.051

Figure Lengend Snippet:

Article Snippet: pLVTHM-ShTSPAN5 was obtained by ligation of previously described ShRNA sequence specific for rat TSPAN5 (CAGGACAATTTAACCATTGTG) ( ) into pLVTHM vector, at MluI/ClaI sites. pLVTHM-Scrambled was obtained by inserting a sequence derived by random mixing of the bases from ShTSPAN5 (GCAAATTCGTGTCGTATAACA) in pLVTHM sites MluI/ClaI. pSICOR was obtained from Addgene #11579 and modified by substitution of the CMV promoter with a human ubiquitin C (UBC) promoter in restriction sites NotI/NheI.

Techniques: Transduction, Recombinant, Modification, Software, Imaging